Skip to main content

Advertisement

Table 3 Primer sequences of genes of interest. Sequences were obtained from Canis lupus familiaris.

From: Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer

Gene GenBank Accession number   primer sequence Product size
PRSS11 XM_535044 Sense TGCTTTCGGAGCGTATATC 159 bp
   Anti-sense CCATGTTCAGGGTGTTCTCC  
MTSS1 XM_539158 Sense GACTCCCTTCAGTGCTCCAG 189 bp
   Anti-sense CCGGTAAGACTGGCTGATGT  
CLPTM1 XM_541570 Sense TGAGGGCCTTGTAAGTGAGC 151 bp
   Anti-sense CACAAGGGCTGGTACTCCTG  
SMYD2 XM_537149 Sense GCTTGTACATGCAGGACTGG 202 bp
   Anti-sense CCGTGAGCCACTTCCATTAT  
GAPDH NM_001003142 Sense GGGTCATCATCTCTGCTCCT 150 bp
   Anti-sense AGTGGTCATGGATGACTTTGG