Skip to main content

Table 1 Primer sets used in this study

From: Prevalence and phylogenetic analysis of hepatitis E virus in pigs, wild boars, roe deer, red deer and moose in Lithuania

Primer designation Sequence (5ʹ → 3ʹ) Step Product length (bp) Target region
HEV-s TCGCGCATCACMTTYTTCCARAA RT-PCR 469 ORF1
HEV-as GCCATGTTCCAGACDGTRTTCCA
HEV-fn TGTTGCCCTGTTTGGCCCCTGGTTTAG Nested
RT-PCR
254
HEV-rn CCAGGCTCACCRGARTGYTTCTTCCA
3156F AATTATGCYCAGTAYCGRGTTG RT-PCR 731 ORF2
3157R CCCTTRTCYTGCTGMGCATTCTC
3158Fn GTWATGCTYTGCATWCATGGCT Nested
RT-PCR
348
3159Rn AGCCGACGAAATCAATTCTGTC