Skip to main content

Table 2 Primer sequences

From: Prevalence of human pathogenic Yersinia enterocolitica in Swedish pig farms

qPCR Primer name Primer sequence Amplicon (bp)
Y. enterocolitica, ail-gene [29] Forward primer: CCCAGTAATCCATAAAGGCTAACATAT 163
Reverse primer: ATGATAACTGGGGAGTAATAGGTTC
Probe: (FAM-MGB prob) TGACCAAACTTATTACTGCCATA
Genus Yersinia, inv-gene [30] Forward primer: TTGACACAACCTTAGGCAATATGG 73
Reverse primer: ACTGGTCAATGGTGCGCTATAA
Probe: (FAM-MGB prob) CGTTATCACGGATCACAATGACGGCA