Skip to main content

Table 1 Giardia duodenalis and Eimeria spp. primers used in this study

From: Occurrence of faecal endoparasites in reindeer (Rangifer tarandus) in two grazing areas in northern Norway

Primer name Primer sequence Target Prod. Size Reference
Giardia primers
 GDHeF TCAACGTYAAYCGYGGYTTCCGT bg 432 [10]
 GDHiR GTTRTCCTTGCACATCTCC
 GDHiF CAGTACAACTCYGCTCTCGG
 G7 AAGCCCGACGACCTCACCCGCAGTGC gdh 515 [11]
 G759 GAGGCCGCCCTGGATCTTCGAGACGAC
 βGiarF GAACGAGATCGAGGTCCG
 βGiarR CTCGACGAGCTTCGTTGTT
 AL4303 ATCCGGTCGATCCTGCCG tpi 255 [12]
 AL4305 AGGATCAGGGTTCGACT
 AL4304 CGGTCGATCCTGCCGGA
 AL4306 GGCGGAGGATCAGGGT
 RH11 CATCCGGTCGATCCTGCC 18SSU 292 [13]
 RH4 AGTCGAACCCTGATTCTCCGCCAGG
Eimeria primers
 Cocci_COI_For GGTTCAGGTGTTGGTTGGAC coi  ~ 800 [14]
 Cocci_COI_Rev AATCCAATAACCGCACCAAG
 TK2 GGTTGATCCTGCCAGTAGTC 18SSU  ~ 1.800 [15]
 ets2 AATCCCAATGAACGCGACTCA
 TK1 AGTAGTCATATGCTTGTCTC
 ITS-For GCAAAAGTCGTAACACGGTTTCCG its 200–440 [16]
 ITS-Rev CTGCAATTCACAATGCGTATCGC