Skip to main content

Table 1 Sequence design of primers and TaqMan probes for each animal species was based on the 3’-untranslated region of the corresponding myosin heavy chain slow gene

From: Investigation into the animal species contents of popular wet pet foods

Host species   
Cow Forward TGAGAGGGCACAGGACTTTCA
  Reverse CAGTGGAGGCTGTGTCTGGAA
  Probe CCGTAGCTTCATCCC
Horse Forward TGAGAGGCTGAGGACTTGCA
  Reverse ATGGTGGTGGCCGTGTCT
  Probe TGGCCAACTATCCTTC
Pig Forward CCCATGAGGCTCGGAACA
  Reverse AGGAGGTGCAAGGAGCATGT
  Probe CCTACTGCAACAATG
Chicken Forward GGGTGATAAGGAGGCCAGAAA
  Reverse CACTACTTCCTGGTGCCAACAG
  Probe AGCCCCATTCCTG