Table 1 Nucleotide sequence of primers used in PCR amplification and sequencing
From: Isolation of equid alphaherpesvirus 3 from a horse in Iceland with equine coital exanthema
Gene | Primers sequence 5′–3′ | Locationa | Amplicon size (bp) | GenBank no | Size of sequence strand (bp) | |
|---|---|---|---|---|---|---|
Glycoprotein G | ||||||
Forward | ACCACCTGCGAGACCATTAC | 566–585 | 616 | MN689934 | 590 | |
Reverse | TAGTTGGTCCCCTTCTGCTG | 1162–1181 | ||||
DNA polymerase | ||||||
Forward | CCCGTTGATGACCCCTATGT | 822–841 | 321 | MN689935 | 321 | |
Reverse | TAGCAGCATGTCTCGCCC | 1125–1142 | ||||