Skip to content

Advertisement

  • Research
  • Open Access

DNA microarray-based detection of Coxiella burnetii, the causative agent of Q fever

Acta Veterinaria Scandinavica201456:27

https://doi.org/10.1186/1751-0147-56-27

  • Received: 9 December 2013
  • Accepted: 5 May 2014
  • Published:

Abstract

Background

An easy-to-handle microarray assay based on the cost-effective ArrayTube™ platform has been designed for the rapid and unequivocal identification of Coxiella burnetii, the causative agent of Q fever. The gene targets include the chromosomally coded markers icd, omp/com 1, and IS1111 as well as the plasmid coded markers cbbE and cbhE.

Results

A representative panel comprising 50 German C. burnetii isolates and 10 clinical samples was examined to validate the test. All tested isolates harboured plasmid QpH1 and were correctly identified, corresponding to 100% sensitivity. The assay’s limit of detection was 100 genome equivalents (GE) for icd, omp/com 1, cbbE and cbhE and 10 GE for IS1111. Assay specificity was 100% as determined by analysing a panel of 37 non-Coxiella strains.

Conclusions

The present array is a rational assembly of established and evaluated targets for the rapid and unequivocal detection of C. burnetii. This array could be applied to the screening of vaginal swabs from small ruminants; screening of environmental samples e.g. on farms or screening of human samples.

Keywords

  • Coxiella burnetii
  • Q fever
  • Oligonucleotide microarray
  • Hybridisation
  • PCR
  • Zoonosis

Background

The causative agent of the zoonosis Q fever, Coxiella burnetii is listed by the United States Centers for Disease Control and Prevention (CDC) as a Category B pathogen and potential bioterrorism agent [1]. This small, Gram-negative, nonmotile, obligate intracellular bacterium is highly infectious and experimental data suggest that less than 10 organisms can cause infection. In animals, infection takes mostly a subclinical or inapparent course but abortions or birth of weak offspring, especially in small ruminants, can occur [2, 3]. In humans, the clinical picture can range from asymptomatic to severe, usually presenting with fever, severe headache, myalgia and fatigue, frequently accompanied by atypical pneumonia and/or hepatitis. Chronic Q fever, i.e. persistence of infection exceeding a period of six months duration, may lead to endocarditis, which can be fatal. Additionally, chronic hepatitis, osteomyelitis, and septic arthritis are known sequelae [4].

Clinical diagnosis of C. burnetii infections in man and animal usually relies on serology, despite molecular methods such as PCR-based assays being more suitable in terms of speed and specificity, especially within the first couple of weeks after onset of disease [57]. However, although PCR assays are generally very fast and sensitive, their multiplexing capacity is limited. Moreover, due to their high specificity, they are incapable of detecting e.g. novel species or variants of a known species [8]. Microarrays on the other hand can be designed with a multitude of different probes either suitable for species identification by using highly specific probes, or for the detection of related or novel species by using probes lying within conserved regions [8]. A further benefit of the multiple targets on an array is that they can partly mitigate the weakness of diagnostic PCR assays when the PCR primer target contains point mutations. These mutations can be present in variants within a species and can lead to false negative results.

In this study, we describe a microarray-based method adapted to the ArrayTube™ (AT) platform, using three chromosomal (icd, omp/com 1, and IS1111) and two plasmid (cbbE, cbhE) coded targets for the detection of C. burnetii. This platform has repeatedly been shown to be suitable for detecting other biological agents such as Burkholderia mallei/pseudomallei, Brucella spp., Bacillus anthracis, and Chlamydia spp. [912], for bacterial species differentiation and genotyping [13] and for automation-based applications.

Methods

Cell culture and bacterial isolates

The heat inactivated preparations of C. burnetii isolates and clinical samples used in this study were obtained from the National Reference Laboratory of Q Fever at the Federal Research Institute for Animal Health (Friedrich-Loeffler-Institut (FLI), Jena, Germany) [14] (Table 1).
Table 1

Panel of tested Coxiella isolates and clinical samples isolated in Germany

Year

Identifier

Host

Sample

Year

Identifier

Host

Sample

1997

DP677

fallow deer

isolate

2009

DP758

goat

isolate

1997

DP684

cattle

isolate

2009

DP792

sheep

isolate

1997

DP822

goat

isolate

2009

DP795

sheep

isolate

1998

DP682

goat

isolate

2009

DP798

sheep

isolate

1998

DP685

tick

isolate

2009

DP801

sheep

isolate

1998

DP751

sheep

isolate

2009

DP804

sheep

isolate

1998

DP752

sheep

isolate

2009

DP807

sheep

isolate

1998

DP759

tick

isolate

2009

DP810

sheep

isolate

1999

DP683

sheep

isolate

2009

DP813

sheep

isolate

1999

DP730

cattle

isolate

2010

12Q1649

cattle

isolate

2001

DP678

sheep

isolate

2011

12Q1650

sheep

isolate

2001

DP748

cattle

isolate

2011

12Q1651

sheep

isolate

2001

DP753

sheep

isolate

2011

12Q1652

sheep

isolate

2002

DP734

cattle

isolate

2011

12Q1653

sheep

isolate

2002

DP791

sheep

isolate

2011

12Q1654

sheep

isolate

2003

DP676

human

isolate

2011

12Q1655

sheep

isolate

2003

DP679

cattle

isolate

2011

12Q1656

sheep

isolate

2003

DP680

sheep

isolate

2012

12Q1657

cattle

isolate

2003

DP749

cattle

isolate

2012

12Q1658

cattle

isolate

2003

DP754

sheep

isolate

    

2004

DP681

goat

isolate

    

2004

DP731

sheep

isolate

2008

15/24

sheep

vaginal swab

2004

DP732

sheep

isolate

2009

34/19

sheep

vaginal swab

2004

DP733

sheep

isolate

2009

34/23

sheep

vaginal swab

2004

DP735

cattle

isolate

2009

34/25

sheep

vaginal swab

2005

DP698

sheep

isolate

2009

34/51

sheep

vaginal swab

2007

DP819

cattle

isolate

2009

34/53

sheep

vaginal swab

2008

DP750

cattle

isolate

2009

34/54

sheep

vaginal swab

2008

DP756

goat

isolate

2011

11Q3592

sheep

vaginal swab

2008

DP790

goat

isolate

2012

12Q0778

sheep

vaginal swab

2008

DP816

sheep

isolate

2013

13Q2139

sheep

vaginal swab

All non-Coxiella bacteria used in this study were obtained from the German Collection of Microorganisms and Cultures (DSMZ, Braunschweig, Germany), and from the strain collection of the Institute of Bacterial Infections and Zoonoses at the Federal Research Institute for Animal Health (FLI, Jena, Germany). Bacteria were grown on standard media under conditions recommended by the respective bacterial strain collections. DNA from Bartonella spp, Chlamydia spp, Francisella spp, Salmonella typhimurium, Haemophilus influenzae, and Legionella pneumophila was obtained from the Institute for Medical Microbiology and Infection Control, Goethe University, Frankfurt/M., from the National Reference Laboratory of Psittacosis, from the National Reference Laboratory of Tularaemia and from the National Reference Laboratory of Salmonellosis at the FLI, Jena, from IDEXX in Ludwigsburg, and from the Institute for Medical Microbiology, Jena, respectively (Table 2).
Table 2

Panel of non- Coxiella strains used for specificity testing

Species

Isolate

Species

Isolate

Actinobacillus pleuropneumoniae

ATCC 27088

Haemophilus influenzae

ATCC 9006

Bacillus cereus

ATCC 10876

Klebsiella pneumoniae

 

B. megaterium

ATCC 14581

subsp. pneumoniae

DSM 30104

B. subtilis

ATCC 6633

Lactobacillus ruminis

DSM 20403

B. thuringiensis

ATCC 10792

Legionella pneumophila

 

Bartonella henselae

Marseille

subsp. pneumophila

DSM 7513

B. quintana

JK-31

Mannheimia haemolytica

ATCC 33396

Bordetella bronchiseptica

ATCC 19395

Oligella urethralis

DSM 7531

Brucella abortus

ATCC 23448

Pasteurella multocida

DSM 5281

B. melitensis

ATCC 23456

Proteus mirabilis

DSM 4479

B. suis

ATCC 23444

Pseudomonas aeruginosa

ATCC 9027

Burkholderia pseudomallei

ATCC 23343

P. alcaligenes

ATCC 14909

B. cepacia

ATCC 25416

P. fluorescens

ATCC 13525

B. mallei

ATCC 23344

P. polymyxa

ATCC 842

Chlamydia psittaci

C1/97

Rhodococcus equi

DSM 20307

C. abortus

07 DC0059

Salmonella typhimurium

9098

Escherichia coli

DSM 30083

Staphylococcus aureus

DSM 6732

Francisella tularensis subsp.

 

Streptococcus equinus

DSM 20558

tularensis

SchuS4/ FSC 237

S. parauberis

DSM 6631

F. tularensis subsp. holartica

LVS/ FSC 155

Yersinia enterocolitica

 
  

subsp. palearctica (Y 11)

DSM 13030

ATCC: American Type Culture Collection; DSM: Deutsche Stammsammlung für Mikroorganismen, Germany; FSC: Francisella Isolate Collection, Sweden.

DNA extraction and quantification

Genomic DNA from inactivated preparations of C. burnetii isolates and from non-Coxiella bacteria was isolated using the High Pure PCR Template Preparation Kit™ (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Quality and purity of the DNA were determined using a Nanodrop ND-1000 spectrophotometer (PEQLAB Biotechnologie GmbH, Erlangen, Germany). DNA quantification was performed with a TaqMan based real-time PCR assay targeting the transposase element IS1111 or the isocitrate dehydrogenase gene (icd) as described by Klee et al. [15] and Hildebrandt et al. [16]. DNA quantification for NineMile RSA493 was performed with the IS1111 real-time PCR assay and genome equivalents (GE) were calculated with 20 IS1111 copies per genome. Priscilla Q177 DNA was quantified with an icd real-time PCR assay and GE calculation was done with one icd copy per genome. Reaction conditions have been described previously [16] with the exception of the master mix (Maxima™ Probe qPCR Master Mix, Fermentas, St. Leon-Rot, Germany) and thermocycler (Mx3000P Thermocycler, Agilent Technologies, Santa Clara, CA, USA).

Primer and probe design

Gene specific primers and probes were designed and optimised using the Array Design software package (Alere Technologies GmbH, Jena, Germany) and the published target sequences from the reference strains NineMile RSA493 (GenBank: AE016828), Henzerling RSA331 and Priscilla Q177. After design, all primers and probes were blasted against the complete GenBank™ database (http://www.ncbi.nlm.nih.gov/BLAST/).

Microarray layout and fabrication

Oligonucleotides were purchased as 3'-amino-modified oligonucleotides from metabion (Martinsried, Germany) and diluted in Spotting Buffer 1 (Quantifoil Micro Tools, Jena, Germany) to a final concentration of 10 μM. Arrays were spotted with six-fold redundancy on surface-coated glass using Alere Technologies spotting machines and assembled into array tubes as described previously [17, 18]. Internal staining controls (3’-amino and 5’-biotin-modified oligonucleotides) were included for staining control and orientation, as well as negative controls (0.1 M Sodium Pyrophosphate (NaPP) Standard pH 9). Probe sequences and array layout are shown in Table 3, and Figure 1, respectively.
Table 3

Sequences of oligonucleotide probes printed onto the microarray

Probe

Target gene

Sequence (5’ → 3’)

Tm (°C)

GC (%)

Length (nt)

1a

icd

CCTGACCGACCCATTATTCCCTTTATCGAAGGAG

66,1

50,0

34

1b

 

CCTGACCGACCCATTATTCCCTTTATCGAAGG

65,1

50,0

32

1c

 

CCCATTATTCCCTTTATCGAAGGAGATGGGATTGG

64,9

46,0

35

2a

omp/com1

CGTGGCGATAGCCGCCCCCTCTCAAT

69,3

65,0

26

2b

 

CTCCTCAACAAGTCAAAGACATACAAAGCATCG

63,3

42,0

33

2c

 

CAAAGCATCGTCCACCATTATTTAGTCAACC

62,0

42,0

31

3a

IS1111

GTAAAGTGATCTACACGAGACGGGTTAAGCG

64,0

48,0

31

3b

 

GCTCAGTATGTATCCACCGTAGCCAGTCTTAAG

64,6

48,0

33

3c

 

CTGCGTGGTGATGGAAGCGTGTGGAG

66,9

62,0

26

4a

cbbE

CTAAGAAACTGCTTAAGAGAGGGCAGGGAACG

65,3

50,0

32

4b

 

GGGCAGGGAACGATAGTGTGTTGCGGTATTTAC

67,3

52,0

33

4c

 

CTTGAAAAACGTAGCGGAAAAGGGACAGTACG

65,0

47,0

32

5a

cbhE

GCTTATTTCGCCCTCGCTGACGGAAGAGGATC

68,6

56,0

32

5b

 

CGGAAGAGGATCTTTTAGGTCGAATTAGACAGAGATAC

64,0

42,0

38

5c

 

GCTGGGGGCCAAGAAAAGTTTGCAGACCAG

68,5

57,0

30

H

HybCtr

GACTTACCAACACATCAAAGTTCCCAGC

61,7

46,0

28

Figure 1
Figure 1

Array layout, probe location, hybridisation patterns and hybridisation images for Coxiella burnetii strains NineMile RSA493, Priscilla Q177 and the non-template control (HPLC grade H 2 O).

PCR amplification of target genes and generation of hybridisation control DNA

The 20 μL PCR reaction mixture contained 1 x 5 PRIME HotMasterMix (VWR International GmbH, Darmstadt, Germany), 0.3 μM forward primer, and 0.3 μM 5’-end biotinylated reverse primer (icd: AT_ICD-F/R, omp/com 1: AT_Omp-F/R, IS1111: AT_IS-F/R, cbb E: AT_CbbE-F/R, cbb E: AT_CbhE-F/R, Table 4). Amplifications were performed using a Mastercycler ep® (Eppendorf, Germany). The reaction was started with a 1 min denaturation step at 96°C, followed by 35 cycles with 15 s of denaturation at 96°C, 20 s for annealing at 55°C, and 30 s for extension at 70°C. After a final 5 min extension step at 70°C the reaction was stopped and the PCR products submitted to electrophoresis. Hybridisation control DNA was generated from 105 GE of the C. burnetii type strain (NineMile RSA493) using the PCR conditions above and the primer pair HybCtr-F (biotinylated) and HybCtr.
Table 4

Primers used for amplification of target genes and hybridisation control

Name

Target gene

Sequence (5’ → 3’)

PCR product size (bp)

Tm (°C)

GC (%)

Length (nt)

AT_ICD-F

icd

CGGAGTTAACCGGAGTATCCATC

178

57,6

52,0

23

AT_ICD-R

 

GCATCGACCACGTTTTTCATG

 

56,2

48,0

21

AT_Omp-F

omp/com1

GCACTATTTTTAGCCGGAACC

144

54,9

48,0

21

AT_Omp-R

 

TGCTTCTACTAAAACTTCTGGG

 

53,0

41,0

22

AT_IS-F

IS1111

CTGTGTGGAATTGATGAGTGG

142

54,2

48,0

21

AT_IS-R

 

ACGTCCGATACCAATGGTTC

 

55,0

50,0

20

AT_CbbE-F

cbbE

TAAGGGACATCCACTACCGG

147

55,5

55,0

20

AT_CbbE-R

 

CCCAAATTTAGATCGTCACATTG

 

53,6

39,0

23

AT_CbhE-F

cbhE

CGATGTCAACTCTAGAGAGC

147

52,5

50,0

20

AT_CbhE-R

 

GCAATCTGCTCGGCAATAAAG

 

55,6

48,0

21

HybCtr-F

ICD (HybCtr)

CGGAGTTAACCGGAGTATCCATC

95

57,6

52,0

23

HybCtr-R

 

AACTTCTAAAACGGCTTTATTAAC

 

51,5

29,0

24

Hybridisation and data analysis

Hybridisation was carried out at 55°C for 60 min [10]. The hybridisation reaction was monitored using the ATR-01™ array tube reader (Alere Technologies) at 25°C for 10 min, recording one image at the end of incubation time. Signal intensity data with local background correction were obtained using the Iconoclust™ software, version 3.0 and Pionir/PARTISAN™ arrayLIMS software (Alere Technologies GmbH). The normalised intensity (NI) was calculated for each spot using the following equation: NI = 1-(M/BG), with M being the average intensity of the recognised spot and BG the intensity of its local background (Pionir/PARTISAN™ software). Values <0.15 were considered negative, values ≥0.15 positive.

Determination of assay specificity and detection limit

In order to assess assay specificity, DNA from a panel of 37 type or in-house reference strains of different bacterial origin was submitted to the above described PCR procedure and subsequent hybridisation (Table 2). The detection limit was the smallest amount of Coxiella DNA detected by the test system for each individual target, and was determined in duplicate using tenfold serial dilutions containing 105 to 100 genome equivalents (GE) of NineMile RSA493 and Priscilla Q177, respectively.

Results

PCR amplification of target genes

Using the reference strains NineMile RSA493 (GenBank: AE016828), Henzerling, and Priscilla Q177, five separate PCR assays where established and optimised for each target (Table 3). All gene targets were successfully amplified and the obtained fragment sizes corresponded to the theoretical values (Table 4) calculated by in silico analysis of the respective target sequences (data not shown).

Oligonucleotide probes and microarray layout

The selection of the microarray probe panel was based on five well characterised genetic markers of C. burnetii. The chromosomal target regions (icd, omp/com 1, IS1111) were chosen due to their genetic stability. The plasmid coded target regions (cbbE, cbhE) were selected to identify the Coxiella-specific plasmids QpRS and QpH1 [19, 20]. After initial BLAST analysis, all available sequences for the specific targets were used for sequence alignments. The final microarray layout consisted of 16 oligonucleotide probes of 26-38 bp in length with six-fold redundancy (Figure 1).

Hybridisation results

Initially, hybridisation experiments were done with three reference strains (Nine Mile RSA493, Henzerling RSA331 and Priscilla Q177). Biotin-labelled amplification products of every individual target were pooled and applied to the array. The hybridisation patterns of all three reference strains complied with two patterns; these had been predicted from the in silico analysis of target region sequences derived from the GenBank™ sequence database: pattern 1 for RSA493 and RSA331, and pattern 2 for Q177, respectively (Figure 1).

In order to validate the new diagnostic assay, German C. burnetii isolates obtained from the German Q-fever network (http://www.fli.bund.de/de/startseite/institute/institut-fuer-bakterielle-infektionen-und-zoonosen/projekte/bmbf-verbundprojekt-q-fieber.html), and from the German National Reference Laboratory for Q fever were tested; a sample panel of 50 different isolates and 10 clinical samples (vaginal swabs) collected in Germany between 1997 and 2013 from sheep, goats, cattle, fallow deer, ticks, and humans were applied to the array. All analysed isolates revealed hybridisation signals corresponding to pattern 1.

Determination of detection limits and assay specificity

The assay detection limit of every target was tested with RSA493 and Q177 in serial dilutions of DNA. Every marker was reliably detected down to DNA amounts of 100 genome equivalents (GE), whereby IS1111 detection was more sensitive with a detection limit of 10 GE (data not shown). The assay specificity was evaluated with 37 type or in-house reference strains of various bacterial species (Table 2). No signals were observed in any of the hybridisation experiments with the test panel and internal hybridisation controls, thus confirming 100% assay specificity.

Discussion

Diagnosis of Q fever in animal and man usually relies on serological methods, such as indirect immunofluorescence, complement fixation or enzyme-linked immunosorbent assays [5, 21]. However, since C. burnetii-specific antibodies only begin to appear several weeks after infection, diagnosis is delayed. DNA based diagnostic assays are therefore more appropriate in terms of speed and specificity, and a plethora of PCR assays suitable for the detection of C. burnetii have been developed [15, 22]. Although these assays are usually fast and sensitive and therefore more than adequate for most diagnostic applications, their capacity for multiplexing is limited [8]. This shortcoming has been resolved by using different types of DNA microarrays which have proved to be suitable for a broad range of applications in the microbial research and diagnostics of Q fever [7, 23, 24].

The microarray used in the present study was designed to target the chromosomally coded single copy genes isocitrate-dehydrogenase icd, the outer membrane protein-coding gene omp/com 1 and the transpoase gene in the multi copy insertion element IS1111 as well as the plasmid coded markers cbbE on QpRS and cbhE on QpH1. All these markers have been characterised extensively and their suitability as targets for detecting C. burnetii has been confirmed in numerous studies [19, 2529].

The analytical sensitivity of the assay used in the present study was 100 GE for the single copy gene targets icd and omp/com 1 as well as for the plasmid coded targets cbbE and cbhE and 10 GE for the IS1111. Comparable values have been reported by Janse et al. [7], for icd and IS1111 using suspension microarrays and for IS1111 in a multiplex PCR targeting icd, omp/com 1 and IS1111 by de Bruin et al., [29]. The specificity of the array was 100% with the tested non-Coxiella strains, including the phylogenetic neighbours Legionella spp. and Francisella spp. as well as with Bartonella spp. which have been reported to cross react with Coxiella in serological assays [30]. We did not observe any cross reactions between probes or primers and sample DNA as reported by Janse et al. [7], which could be due to the different oligonucleotide design and different array chemistry.

C. burnetii can harbour four different plasmids of different size and composition, namely QpH1, QpRS, QpDG, QpDV and the chromosomally integrated plasmid-like sequences IPS [25, 31, 32]. Their role in the biology of C. burnetii is still not clear, but some plasmid genes appear to be essential for conserved functions [33]. Moreover, a potential influence of the different C. burnetii plasmids on animal and human disease has been discussed [34]. Early studies suggested that the plasmids QpH1 and QpRS are markers for acute or chronic disease, respectively [32], but this assumption could not be verified in a later study [35]. A small, recent study testing the hypothesis that obstetric complications in C. burnetii infections were associated with a particular genotype and the presence of QpDV, found that this plasmid type was detected more frequently in isolates associated with abortions [36]. All samples tested in the present study originated from Germany and harboured the plasmid QpH1. This plasmid type seems to be the predominant type in the isolates circulating in Germany and allegedly the Netherlands [14, 36]. Since the present array only includes probes for the plasmids QpH1 and QpRS, which currently appear to be the most frequently occurring plasmid types in C. burnetii[14, 35], the existing array could be improved by implementing additional probes for the other known plasmids of C. burnetii.

Several arrays have been developed for the detection of C. burnetii[7, 23, 36, 37]. These arrays range from easy-to-handle, cheap but inflexible in terms of further probe implementation, to highly sophisticated, expensive-on-purchase but flexible regarding assay design. The ArrayTube™ platform is an easy-to-handle, middle price range (approx. 15 Euro/Array and PCR), molecular test for high-throughput and parallel analysis of samples. Array designs can be readily expanded by adding further gene targets. Moreover, the modular composition of the platform allows the rapid assembly of custom-made assays, targeting different biological agents, e. g. as part of a Bioweapon-agent-array detecting C. burnetii, Brucella spp., B. mallei/pseudomallei, B. anthracis and Chlamydia spp.[912].

Conclusions

The present array is a rational assembly of established and evaluated targets for the rapid and unequivocal detection of C. burnetii. This array could be applied to the screening of vaginal swabs from small ruminants, screening of environmental samples e.g. on farms, for screening patients with infective endocarditis [38], or of blood donors in regions of high endemicity for Q fever, e.g. the German-Dutch border area, or in a diagnostic assay screening for atypical pneumonias [23].

Abbreviations

AT: 

Array tube

GE: 

genome equivalent

IS1111: 

Insertion element 1111

icd: 

Isocitrate dehydrogenase

omp/com1: 

Outer membrane protein

NTC: 

Non-template control

PCR: 

Polymerase chain reaction

HPLC: 

High performance liquid chromatography.

Declarations

Acknowledgment

The authors would like to thank Dr. K. Henning for providing the C. burnetii isolates. Dr. A. Rassbach is thanked for providing the panel of non-Coxiella bacterial strains; Prof. V. Kempf (Frankfurt/M.), Dr. P. Kopp (Ludwigsburg), PD Dr. U. Methner (Jena), PD Dr. J. Rödel (Jena), Dr. K. Sachse (Jena) and PD Dr. H. Tomaso (Jena) are thanked for supplying bacterial DNA. Nadin Lemser is thanked for her excellent technical assistance. Dr. M. J. Sprague is thanked for stylistic improvements of the manuscript. Parts of the present study were presented as a poster at the “National Symposium on Zoonoses Research 2012” in Berlin (October 11–12, 2012). This project was supported by funding from the Federal Ministry for Education and Research (BMBF #01KI1001A).

Authors’ Affiliations

(1)
Friedrich-Loeffler-Institut, Institut für Bakterielle Infektionen und Zoonosen, Naumburger Str. 96a, Jena, 07743, Germany
(2)
Alere, Löbstedter Str. 103, Jena, 07749, Germany

References

  1. Hanczaruk M, Cutler S, Toman R, Frangoulidis D: Coxiella burnetii. Q Fever. BSL3 and BSL4 Agents: Epidemiology, Microbiology and Practical Guidelines. Edited by: Elschner M, Cutler S, Weidmann M, Butaye P. 2012, Weinheim: Wiley-Blackwell, 57-69. 1View ArticleGoogle Scholar
  2. Maurin M, Raoult D: Q fever. Clin Microbiol Rev. 1999, 12: 518-553.PubMed CentralPubMedGoogle Scholar
  3. Rodolakis A: Q-fever in dairy animals. Ann N Y Acad Sci. 2009, 1166: 90-93. 10.1111/j.1749-6632.2009.04511.x.View ArticlePubMedGoogle Scholar
  4. Oyston PC, Davies C: Q fever: the neglected biothreat agent. J Med Microbiol. 2011, 60: 9-21. 10.1099/jmm.0.024778-0.View ArticlePubMedGoogle Scholar
  5. Fournier PE, Raoult D: Comparison of PCR and serology assays for early diagnosis of acute Q fever. J Clin Microbiol. 2003, 41: 5094-5098. 10.1128/JCM.41.11.5094-5098.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Schneeberger PM, Hermans MH, van Hannen EJ, Schellekens JJ, Leenders AC, Wever PC: Real-time PCR with serum samples is indispensable for early diagnosis of acute Q fever. Clin Vaccine Immunol. 2010, 17: 286-290. 10.1128/CVI.00454-09.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Janse I, Bok JM, Hamidjaja RA, Hodemaekers HM, van Rotterdam BJ: Development and comparison of two assay formats for parallel detection of four biothreat pathogens by using suspension microarrays. PLoS One. 2012, 7: e31958-10.1371/journal.pone.0031958.PubMed CentralView ArticlePubMedGoogle Scholar
  8. McLoughlin KS: Microarrays for pathogen detection and analysis. Brief Funct Genomics. 2011, 10: 342-353. 10.1093/bfgp/elr027.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Schmoock G, Ehricht R, Melzer F, Elschner M, Tomaso H, Neubauer H, Al Dahouk S: Development of a diagnostic multiplex polymerase chain reaction microarray assay to detect and differentiate Brucella spp. Diagn Micr Infec Dis. 2011, 71: 341-353. 10.1016/j.diagmicrobio.2011.08.013.View ArticleGoogle Scholar
  10. Schmoock G, Ehricht R, Melzer F, Rassbach A, Scholz HC, Neubauer H, Sachse K, Mota RA, Saqib M, Elschner M: DNA microarray-based detection and identification of Burkholderia mallei, Burkholderia pseudomallei and Burkholderia spp. Mol Cell Probes. 2009, 23: 178-187. 10.1016/j.mcp.2009.04.001.View ArticlePubMedGoogle Scholar
  11. Felder KM, Hoelzle K, Wittenbrink MM, Zeder M, Ehricht R, Hoelzle LE: A DNA microarray facilitates the diagnosis of Bacillus anthracis in environmental samples. Lett Appl Microbiol. 2009, 49: 324-331. 10.1111/j.1472-765X.2009.02664.x.View ArticlePubMedGoogle Scholar
  12. Sachse K, Laroucau K, Hotzel H, Schubert E, Ehricht R, Slickers P: Genotyping of Chlamydophila psittaci using a new DNA microarray assay based on sequence analysis of ompA genes. BMC Microbiol. 2008, 8: 63-10.1186/1471-2180-8-63.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Sachse K, Hotzel H, Slickers P, Ehricht R: The use of DNA microarray technology for detection and genetic characterisation of chlamydiae. Dev Biol (Basel). 2006, 126: 203-210.Google Scholar
  14. Hilbert A, Schmoock G, Lenzko H, Moog U, Diller R, Fröhlich A, Hoffmann L, Horner S, Elschner M, Tomaso H, Henning K, Neubauer H, Sprague LD: Prevalence of Coxiella burnetii in clinically healthy German sheep flocks. BMC Res Notes. 2012, 5: 152-10.1186/1756-0500-5-152.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Klee SR, Tyczka J, Ellerbrok H, Franz T, Linke S, Baljer G, Appel B: Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006, 6: 2-10.1186/1471-2180-6-2.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Hildebrandt A, Straube E, Neubauer H, Schmoock G: Coxiella burnetii and coinfections in Ixodes ricinus ticks in Central Germany. Vector Borne Zoonotic Dis. 2011, 11: 1205-1207. 10.1089/vbz.2010.0180.View ArticlePubMedGoogle Scholar
  17. Ehricht R, Adelhelm K, Moneke S, Hulseweh B: Application of Protein Array Tubes to Bacteria, Toxin and Bacteriological Warfare Agent Detection. Microchip Methods in Diagnostics. Volume 509. Edited by: Bilitewski U. 2009, New York: Humana Press, 85-105.View ArticleGoogle Scholar
  18. Monecke S, Ehricht R: Rapid genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolates using miniaturized oligonucleotide arrays. Clin Microbiol Infect. 2005, 11: 825-833. 10.1111/j.1469-0691.2005.01243.x.View ArticlePubMedGoogle Scholar
  19. Zhang GQ, Hotta A, Mizutani M, Ho T, Yamaguchi T, Fukushi H, Hirai K: Direct identification of Coxiella burnetii plasmids in human sera by nested PCR. J Clin Microbiol. 1998, 36: 2210-2213.PubMed CentralPubMedGoogle Scholar
  20. Jäger C, Lautenschlager S, Willems H, Baljer G: Coxiella burnetii plasmid types QpDG and QpH1 are closely related and likely identical. Vet Microbiol. 2002, 89: 161-166. 10.1016/S0378-1135(02)00155-4.View ArticlePubMedGoogle Scholar
  21. Rousset E, Durand B, Berri M, Dufour P, Prigent M, Russo P, Delcroix T, Touratier A, Rodolakis A, Aubert M: Comparative diagnostic potential of three serological tests for abortive Q fever in goat herds. Vet Microbiol. 2007, 124: 286-297. 10.1016/j.vetmic.2007.04.033.View ArticlePubMedGoogle Scholar
  22. Jones RM, Twomey DF, Hannon S, Errington J, Pritchard GC, Sawyer J: Detection of Coxiella burnetii in placenta and abortion samples from British ruminants using real-time PCR. Vet Rec. 2010, 167: 965-967. 10.1136/vr.c4040.View ArticlePubMedGoogle Scholar
  23. Curran T, Coulter WA, Fairley DJ, McManus T, Kidney J, Larkin M, Moore JE, Coyle PV: Development of a novel DNA microarray to detect bacterial pathogens in patients with chronic obstructive pulmonary disease (COPD). J Microbiol Methods. 2010, 80: 257-261. 10.1016/j.mimet.2010.01.004.View ArticlePubMedGoogle Scholar
  24. Leroy Q, Armougom F, Barbry P, Raoult D: Genomotyping of Coxiella burnetii using microarrays reveals a conserved genomotype for hard tick isolates. PLoS One. 2011, 6: e25781-10.1371/journal.pone.0025781.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Valková D, Kazár J: A new plasmid (QpDV) common to Coxiella burnetii isolates associated with acute and chronic Q fever. FEMS Microbiol Lett. 1995, 125: 275-280. 10.1111/j.1574-6968.1995.tb07368.x.View ArticlePubMedGoogle Scholar
  26. Van Nguyen S, To H, Yamaguchi T, Fukushi H, Hirai K: Molecular cloning of an immunogenic and acid-induced isocitrate dehydrogenase gene from Coxiella burnetii. FEMS Microbiol Lett. 1999, 175: 101-106. 10.1111/j.1574-6968.1999.tb13607.x.View ArticlePubMedGoogle Scholar
  27. Hendrix LR, Mallavia LP, Samuel JE: Cloning and sequencing of Coxiella burnetii outer membrane protein gene com 1. Infect Immun. 1993, 61: 470-477.PubMed CentralPubMedGoogle Scholar
  28. Howe GB, Loveless BM, Norwood D, Craw P, Waag D, England M, Lowe JR, Courtney BC, Pitt ML, Kulesh DA: Real-time PCR for the early detection and quantification of Coxiella burnetii as an alternative to the murine bioassay. Mol Cell Probes. 2009, 23: 127-131. 10.1016/j.mcp.2009.01.004.View ArticlePubMedGoogle Scholar
  29. de Bruin A, de Groot A, de Heer L, Bok J, Wielinga PR, Hamans M, van Rotterdam BJ, Janse I: Detection of Coxiella burnetii in complex matrices by using multiplex quantitative PCR during a major Q fever outbreak in The Netherlands. Appl Environ Microbiol. 2011, 77: 6516-6523. 10.1128/AEM.05097-11.PubMed CentralView ArticlePubMedGoogle Scholar
  30. La Scola B, Raoult D: Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii. J Clin Microbiol. 1996, 34: 2270-2274.PubMed CentralPubMedGoogle Scholar
  31. Stoenner HG, Lackman DB: The biologic properties of Coxiella burnetii isolated from rodents collected in Utah. Am J Hyg. 1960, 71: 45-51.PubMedGoogle Scholar
  32. Samuel JE, Frazier ME, Mallavia LP: Correlation of plasmid type and disease caused by Coxiella burnetii. Infect Immun. 1985, 49: 775-779.PubMed CentralPubMedGoogle Scholar
  33. Maturana P, Graham JG, Sharma UM, Voth DE: Refining the plasmid-encoded type IV secretion system substrate repertoire of Coxiella burnetii. J Bacteriol. 2013, 195: 3269-3276. 10.1128/JB.00180-13.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Russell-Lodrigue KE, Andoh M, Poels MW, Shive HR, Weeks BR, Zhang GQ, Tersteeg C, Masegi T, Hotta A, Yamaguchi T, Fukushi H, Hirai K, McMurray DN, Samuel JE: Coxiella burnetii isolates cause genogroup-specific virulence in mouse and guinea pig models of acute Q fever. Infect Immun. 2009, 77: 5640-5650. 10.1128/IAI.00851-09.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Glazunova O, Roux V, Freylikman O, Sekeyova Z, Fournous G, Tyczka J, Tokarevich N, Kovacava E, Marrie TJ, Raoult D: Coxiella burnetii genotyping. Emerg Infect Dis. 2005, 11: 1211-1217.PubMed CentralPubMedGoogle Scholar
  36. Angelakis E, Million M, D'Amato F, Rouli L, Richet H, Stein A, Rolain JM, Raoult D: Q fever and pregnancy: disease, prevention, and isolate specificity. Eur J Clin Microbiol Infect Dis. 2013, 32: 361-368. 10.1007/s10096-012-1750-3.View ArticlePubMedGoogle Scholar
  37. Frangoulidis D, Rodolakis A, Heiser V, Landt O, Splettstoesser W, Meyer H: DNA microarray-chip based diagnosis of Q- fever (Coxiella burnetii). Clin Microbiol Infect. 2009, 15 (Suppl 2): 165-166.View ArticlePubMedGoogle Scholar
  38. Habib G, Hoen B, Tornos P, Thuny F, Prendergast B, Vilacosta I, Moreillon P, de Jesus Antunes M, Thilen U, Lekakis J, Lengyel M, Müller L, Naber CK, Nihoyannopoulos P, Moritz A, Zamorano JL: ESC Committee for Practice Guidelines on the Prevention, Diagnosis, and Treatment of Infective Endocarditis (new version 2009): the Task Force on the Prevention, Diagnosis, and Treatment of Infective Endocarditis of the European Society of Cardiology (ESC). Endorsed by the European Society of Clinical Microbiology and Infectious Diseases (ESCMID) and the International Society of Chemotherapy (ISC) for Infection and Cancer. Eur Heart J. 2009, 30: 2369-2413.View ArticlePubMedGoogle Scholar

Copyright

Advertisement